Detailed Information [109770]
Strain Information
DGRC Number 109770
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Ef1gamma[KM0011]
Genotype w1118; PBac{EGFP-IV}Ef1γKM0011
Break points/Insertion Site 99A1
Related Genes Ef1gamma
Received Date 22 November 2012
Original Number 11
Chromosome 3R
Comments Expression Photo: KM0011

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:25045977 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 99A1
Inserted gene: Ef1gamma
Protein trap?: Yes?(N terminal fusion)
Insertion into Intron or Exon?: Intron or Exon(5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame (both 5'UTR intron and exon)
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:25045977
Chromosome Band 99A1
Flanking Sequence
TTCCTTGCCNCTTTTGTTTCTGAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCGA
TATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCG
CAATATGATTATCTTTCTAGGGTTAAATACGATATAGTGGCAAATTCAGCGAAAAAACGC
GGAGCACACGCACTCACCGGAAACGAAGAAGAGAAGGGACGGAAACAGGGCTGCAGGAGT
CATCATGGTTACGGC
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE