Detailed Information [109772]
Strain Information
DGRC Number 109772
Genotype with FlyBase Link w[1118] PBac{EGFP-IV}CG3011[KM0094]
Genotype w1118 PBac{EGFP-IV}CG3011KM0094
Break points/Insertion Site 5C7
Related Genes CG3011
Received Date 22 November 2012
Original Number 94
Chromosome X
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: X:5810008 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 5C7
Inserted gene: CG3011
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2024-05-17
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point X:5810008
Chromosome Band 5C7
Flanking Sequence
GNNGNNNNGNNNNGGNGNGGGGGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GNTTNNNNTNAACCGCNCGGGNGGGAACAAACGCATATCTGNGAANGNCNNAAAAANTAG
CTGCAGATAAATTAAACCTCGATATACAGCACCGATAAAACACATGCGTCAATCTTTACG
CATGATTATCTTTAACGTACGTCGCAATATGATTATCTTTCTAGGGTTAACAATGATACT
ACTATAAACAACACT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE