| Strain Information | |
|---|---|
| DGRC Number | 109778 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}Df31[KM0176] |
| Genotype | w1118; PBac{EGFP-IV}Df31KM0176 |
| Break points/Insertion Site | 39E3 |
| Related Genes | Df31 |
| Received Date | 22 November 2012 |
| Original Number | 176 |
| Chromosome | 2L |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 2L:21628777 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 39E3 Inserted gene: Df31 Protein trap?: No?? Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 2L:21628777 |
| Chromosome Band | 39E3 |
| Flanking Sequence | TGCCNCTTTTGTTTCTGAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCGATATAC AGACCGNGNAANNANCNGCGTCAATTNNACACANGGATTNNCTTTAAGGTACGTCCGCAT TANGATTNNCNTTCTAGGGTNAATGGGGNTTAATGACAATATAGTCGTTTCTCTCGCACT CATCTACCAACAGATACTCGCCATCTGAGGTAGATAGAATTCTATAGGGCGAACAAAAAG AGAGTTGCAAAGTAG |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |