Detailed Information [109780]
Strain Information
DGRC Number 109780
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}bun[KM0120] / SM6a
Genotype w1118; PBac{EGFP-IV}bunKM0120 / SM6a
Break points/Insertion Site 33E5
Related Genes bun
Received Date 22 November 2012
Original Number 120
Chromosome 2L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2L:12458317 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 33E5
Inserted gene: bun
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 2L:12458317
Chromosome Band 33E5
Flanking Sequence
GGGGNCACTGGTGCCCCTTTTTTTATCTGAAACNAGAAAAATTAGCTGCAGATAAATAAA
CCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGT
ACGTCGCAATATGATTATCTTTCTAGGGTTAAGTAAATTTAGCACTGCAATTATAAATAT
TTACCACACAGACTAACAGTGGCATAGTGTTGACTTAGCTCAACTTACATCCTGTTGCCG
ACTTTAAAAGAGCGT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE