Detailed Information [109785]
Strain Information
DGRC Number 109785
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}heph[KM0225]
Genotype w1118; PBac{EGFP-IV}hephKM0225
Break points/Insertion Site 100E1
Related Genes heph
Received Date 22 November 2012
Original Number 225
Chromosome 3R
Comments Seems to be balanced by TM* with Sb[*]. 14Jul2022 E.O.
Expression Photo: KM0225

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:27765956 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 100E1
Inserted gene: heph
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2022-08-05
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:27765956
Chromosome Band 100E1
Flanking Sequence
NTTNNGGCCCANNTTTGTTTNTGTGGGCAGAAAAAATTAGCTGCAGATAAATAAACCTCG
ATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTC
GCAATATGATTATCTTTCTAGGGTTAAAGAAATCAGAAATCAAAGAGTTCAACTTTATTT
ATGACCTTTTTGAGTTACACAGTTATGTTATAACTTACATGTTGCTAATTAAAAATTAAG
TACTGTTTTTTTTTA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE