Detailed Information [109962]
 

Strain Information
DGRC Number 109962
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}CG45076[KM0406]
Genotype w1118; PBac{EGFP-IV}CG45076KM0406
Break points/Insertion Site 86C6
Related Genes CG45076
Received Date 31 March 2014
Original Number KM0406
Chromosome 3R
Comments Expression Photo: KM0406

Original Source Hiroshi Matsubayashi, Kyoto Institute of Technology
Original Comments Insertion site: 3R:6597714 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 86C6
Inserted gene: CG45076
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: Same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 3R:6597714
Chromosome Band 86C6
Flanking Sequence
CTCGCCCTTGCTCACCATTTTGATTATCTGTAAGGAAGAAAAAATTAGCTGCAGATAAAT
AAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAA
CGTACGTCGCAATATGATTATCTTTCTAGGGTTAAAGGGGGTGGGGGCCAAATCGAAGGA
AAAGAAGTCTAGAAGCGAGGGCCCAGAACAACACTACTCCTGGTTCTGTGTGTCTACGAA
AGCAACGTGCTAAGTACGCTGGACCAACTTACGGTAAAGGGTTCGGTATTGAGGTAATTG
GTCAGGGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCAAAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE