Detailed Information [109973]
Strain Information
DGRC Number 109973
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}KM0608
Genotype w1118; PBac{EGFP-IV}KM0608
Break points/Insertion Site 93F14
Received Date 31 March 2014
Original Number KM0608
Chromosome 3R
Original Source Hiroshi Matsubayashi, Kyoto Institute of Technology
Original Comments No annotated gene.
Insertion site: 3R: 17688531 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 93F14
Inserted gene:
Protein trap?:
Insertion into Intron or Exon?:
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene:
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R: 17688531
Chromosome Band 93F14
Flanking Sequence
GTTTGTGTGGGAGNAGAAANAATTNCCNGCAATATTAACCTCGATATACAGACCGATNAA
ACGNNGCNTCATTTTTNCNCANGATTATCTTTAACGTACGTCNCATTANGATTANCTTTC
TGAGGGTTAANGTGTAATGCGATCTGCGGCGCTCCNGGACGTACCCTTCGGGCATGGCGN
ATTGAAAAAAATCATAGAAAA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE