| Strain Information | |
|---|---|
| DGRC Number | 112462 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}sd[NP1035] / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}sdNP1035 / FM7c |
| Break points/Insertion Site | 13F1 - 13F3 |
| Map Viewer | ![]() |
| Related Genes | CG8509 sd Chc |
| Original Number | 1035 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP1035 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 374 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | a small # of cells (SG) |
| Larval GFP | gut |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-12-28 |
| Research papers using this strain [Please submit your publication] |
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH. Mapping chromatic pathways in the Drosophila visual system. J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference] Otsuna H, Ito K. Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways. J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np17195_0807 |
| Strand | Plus |
| Insertion Point | 15545140 |
| Chromosome Band | X |
| Flanking Sequence | ttttttgtnacttcggtaagcttcggcttcgacgggaccaccttatgttatttcatcatg GGGCGGGCATACTCGTGAATAGCGAAACCTAAAGGAAATCTACGAAAAAAAAGCTGGCTG CATGAAAAACATCACCAGCTCGAGCACTTGCAGCACTGGGCTGCTGCAATTGCAGAACAA CCTGAGCTGCAGCGAGTTGGAAGTTGCCGAGAAGACAGAACAACAGGCAGGTCCGTTGCC CATCCGAATTACCCAGTCATACAAAGACACACCTCGTAAATCCAAACTCTATGCCATAAA CCTACAACTCCACCCCCACCCCACACACCCACTCCACATCCAGCGCCCAAAAGTTTGTCg atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt tcaggaagggcaagccatccgacatgtcatcctntttagaccaatcaaatccatgaagag catccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaa tcgatacagncaactgnctttgacctttggtactactctcttccgatgatgatgtcgcac ttattctatgctgnctcaatggtagaggcatatcagtctcnctggntnnnnnntnnnggg ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnn |