| Strain Information | |
|---|---|
| DGRC Number | 113244 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}tor[NP3370] |
| Genotype | y* w*; P{w+mW.hs=GawB}torNP3370 |
| Break points/Insertion Site | 43E12 |
| Map Viewer | ![]() |
| Related Genes | tor CG1941 |
| Original Number | 3370 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP3370 y[*] seems to be fixed. 06Aug2010 M.T. NP line. Received from the National Institute of Genetics. |
| Also known as | torso Gal4 |
| Cluster id | 575 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | sg |
| Larval GFP | tr |
| Larval X-gal | oenocyte |
| Adult GFP | distal leg, ant, mouth, lab. and stripe of internal cells. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-04-07 |
| Research papers using this strain [Please submit your publication] |
Jun JW, Han G, Yun HM, Lee GJ, Hyun S. Torso, a Drosophila receptor tyrosine kinase, plays a novel role in the larval fat body in regulating insulin signaling and body growth. J Comp Physiol B (2016) 186(6) 701-9 [PubMed ID = 27126913] [RRC reference] Yamanaka N, Romero NM, Martin FA, Rewitz KF, Sun M, O'Connor MB, Leopold P. Neuroendocrine control of Drosophila larval light preference. Science (2013) 341(6150) 1113-6 [PubMed ID = 24009394] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np14285_0727 |
| Strand | Plus |
| Insertion Point | 2770155 |
| Chromosome Band | 2R |
| Flanking Sequence | ctttggggcaaagaccttatttgtatacttcggtaagcttcggctatcgacgggaccacc ttatgttatttcatcatgGGCGGACTCGTTGAATATATTTTGCGCTATTTTGTTTTGATT TGTTTTTCACCTCTTCACTGCATCGTATTGTACTTgatcgaagaatacataagagagaac cgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgaca tgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacg gaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgac ctttgntactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgtta gaggcatatcagtctccactgaagcatnttntttttttgggnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |