Strain Information | |
---|---|
DGRC Number | 113244 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}tor[NP3370] |
Genotype | y* w*; P{w+mW.hs=GawB}torNP3370 |
Break points/Insertion Site | 43E12 |
Map Viewer | ![]() |
Related Genes | tor CG1941 |
Original Number | 3370 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP3370 y[*] seems to be fixed. 06Aug2010 M.T. NP line. Received from the National Institute of Genetics. |
Also known as | torso Gal4 |
Cluster id | 575 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | sg |
Larval GFP | tr |
Larval X-gal | oenocyte |
Adult GFP | distal leg, ant, mouth, lab. and stripe of internal cells. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2022-04-07 |
Research papers using this strain [Please submit your publication] |
Jun JW, Han G, Yun HM, Lee GJ, Hyun S. Torso, a Drosophila receptor tyrosine kinase, plays a novel role in the larval fat body in regulating insulin signaling and body growth. J Comp Physiol B (2016) 186(6) 701-9 [PubMed ID = 27126913] [RRC reference] Yamanaka N, Romero NM, Martin FA, Rewitz KF, Sun M, O'Connor MB, Leopold P. Neuroendocrine control of Drosophila larval light preference. Science (2013) 341(6150) 1113-6 [PubMed ID = 24009394] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np14285_0727 |
Strand | Plus |
Insertion Point | 2770155 |
Chromosome Band | 2R |
Flanking Sequence | ctttggggcaaagaccttatttgtatacttcggtaagcttcggctatcgacgggaccacc ttatgttatttcatcatgGGCGGACTCGTTGAATATATTTTGCGCTATTTTGTTTTGATT TGTTTTTCACCTCTTCACTGCATCGTATTGTACTTgatcgaagaatacataagagagaac cgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgaca tgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacg gaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgac ctttgntactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgtta gaggcatatcagtctccactgaagcatnttntttttttgggnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |