Strain Information | |
---|---|
DGRC Number | 114282 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}cindr[NP7424] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | y* w*; P{w+mW.hs=GawB}cindrNP7424 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | 100A6 |
Map Viewer | |
Related Genes | dj-1beta BcDNA:GH03163 1360{}1463 |
Original Number | 7424 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP7424 NP line. Received from the National Institute of Genetics. |
Balancer | TM6UW23-1 |
Cluster id | 1692 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | sg |
Larval X-gal | sg |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2023-06-09 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np40145_0907 |
Strand | Minus |
Insertion Point | 26634043 |
Chromosome Band | 3R |
Flanking Sequence | cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat gttatttcatcatgGCCTGGAGCCACCTCTAGAGCCACGGCCAAAAAATTGTGTGCCAAA AAATCGTATGGCGTTACGCATCTTGTTATTCTAGTGTCTTTGGCTAGACTATATCTATAT GGAAAATTTCCTACACTAGATACCTCCATTGCGACTACTTACTAATATATTTACAAAGAA AGTAGTTTCCCGGACTTTAATgatcgaagaatacataagagagaaccgtcgccaaagaac ccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttca gaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgnggagtta tcatgatgagctgccgagtcaatcgatacagncaactgtctttgacctttggtactactc tcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtc tccactgagctnttttttngggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnn |