Detailed Information [140826]
Strain Information
DGRC Number 140826
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL04014 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL04014 bw1 / CyO, S* bw1
Break points/Insertion Site 52B5
Related Genes CG30091, Ranbp11 (CG33139)
Received Date 25 October 2007
Original Number LL04014
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:11569419(-)
Cytological Band: 52B5
Gene Symbol-1: CG30091
CG Number-1: CG30091
FlyBase ID-1: FBgn0050091
Insertion Type-1: CDS
Gene Symbol-2: Ranbp11
CG Number-2: CG33139
FlyBase ID-2: FBgn0053139
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Minus
Insertion Point 11569419
Chromosome Band 2R
Flanking Sequence
tctagggttaaGCAGAGCTATGTCGTTTTGGGCCAGGCTAACGAATTTGGGATGCTTGTG
AACAGATGCGACAGCGTAGGTATGCACATCGCCTTGTCCCAGTTGAACCTTTCTAGATGT
ATGTACATACAATTGCACTCAGATTACTCAACTTTCTCCTCCCAAGGGATCAAAGTACTT
ACAATGCCGTACTTTCGGAAATCAACTGCGCCGTTGTCACCACGAAAGCTACAAGAAGAA
CACATTAGTAATCTTTTcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE