Detailed Information [141137]
Strain Information
DGRC Number 141137
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL03898 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL03898 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 33B5
Related Genes CG18787, CG12264
Received Date 9 November 2007
Original Number LL03898
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:11999132(-)
Cytological Band: 33B5
Gene Symbol-1: CG18787
CG Number-1: CG18787
FlyBase ID-1: FBgn0042125
Insertion Type-1: Intron
Gene Symbol-2: CG12264
CG Number-2: CG12264
FlyBase ID-2: FBgn0032393
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Minus
Insertion Point 11999132
Chromosome Band 2L
Flanking Sequence
tctagggttaaAACTATGCAGATGAACTAATAACTTAATTATTTTAGGCAATATCTCAAA
GCCGACATGGAATCCAGCCTCAATGGCAAGATGTGGCCTTTGTCCGCCTACGGACCCTTT
AAGGACAAAGCGAATTTCCCCAACTTTATTCAGGACCAATCCTTcgaattaaccattgtg
ggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE