Detailed Information [141423]
Strain Information
DGRC Number 141423
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL05029 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL05029 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 71B5
Related Genes CG17081, CG16959
Received Date 9 November 2007
Original Number LL05029
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:15115424(+)
Cytological Band: 71B5
Gene Symbol-1: CG17081
CG Number-1: CG17081
FlyBase ID-1: FBgn0036480
Insertion Type-1: Intron
Gene Symbol-2: CG16959
CG Number-2: CG16959
FlyBase ID-2: FBgn0036481
Insertion Type-2: Intron.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Plus
Insertion Point 15115424
Chromosome Band 3L
Flanking Sequence
tttacgcagactatctttctagggTTAAACACGACAGGTCGTGTCGTAAAAGTAAAAACT
GTGTGTTAATGTACATACATAGGTTCTTGATGAACTTTCGTTATGCATAAAAACGAGATA
TCAAAGTAGAATGCTTCCGTTATTGCTTAAGTGCACCAGAACTTTCTCCAAACTCTTGAT
TAATGTTGAAACCCGAGTTTCGCAATCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE