Detailed Information [141425]
Strain Information
DGRC Number 141425
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05035 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05035 bw1 / CyO, S* bw1
Break points/Insertion Site 49B10
Related Genes muskelin (CG8811), CG33792
Received Date 9 November 2007
Original Number LL05035
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:8520179(-)
Cytological Band: 49B10
Gene Symbol-1: muskelin
CG Number-1: CG8811
FlyBase ID-1: FBgn0033757
Insertion Type-1: Putative Promoter
Gene Symbol-2: CG33792
CG Number-2: CG33792
FlyBase ID-2: FBgn0053792
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Minus
Insertion Point 8520179
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAAACAAATAAACATAACTCCAACCGAACAACTT
AAAGCATACGCTAACTACATTTTAATAACTTTGTACACTTGATAAAAAGGCATCACGGTT
GAATGAACAAACAGCTTTCAAATAAATAATCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE