| Strain Information | |
|---|---|
| DGRC Number | 141425 |
| Genotype with FlyBase Link | y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL05035 bw[1] / CyO, S[*] bw[1] |
| Genotype | y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL05035 bw1 / CyO, S* bw1 |
| Break points/Insertion Site | 49B10 |
| Related Genes | muskelin (CG8811), CG33792 |
| Received Date | 9 November 2007 |
| Original Number | LL05035 |
| Chromosome | 2 |
| Original Source | Liqun Luo, Stanford University |
| Original Comments | Location: 2R:8520179(-) Cytological Band: 49B10 Gene Symbol-1: muskelin CG Number-1: CG8811 FlyBase ID-1: FBgn0033757 Insertion Type-1: Putative Promoter Gene Symbol-2: CG33792 CG Number-2: CG33792 FlyBase ID-2: FBgn0053792 Insertion Type-2: Putative Promoter. Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
| General Information | MARCM |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Library & Clone Information |
|---|
| Strand | Minus |
| Insertion Point | 8520179 |
| Chromosome Band | 2R |
| Flanking Sequence | tttacgcagactatctttctagggTTAAAACAAATAAACATAACTCCAACCGAACAACTT AAAGCATACGCTAACTACATTTTAATAACTTTGTACACTTGATAAAAAGGCATCACGGTT GAATGAACAAACAGCTTTCAAATAAATAATCGAAttaaccattgtgggaacactagaac |
| Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |