Detailed Information [141694]
Strain Information
DGRC Number 141694
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL05778 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL05778 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 88D2
Related Genes CG3563, CG7362
Received Date 19 November 2007
Original Number LL05778
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:10585609(+)
Cytological Band: 88D2
Gene Symbol-1: CG3563
CG Number-1: CG3563
FlyBase ID-1: FBgn0038259
Insertion Type-1: Intron
Gene Symbol-2: CG7362
CG Number-2: CG7362
FlyBase ID-2: FBgn0038258
Insertion Type-2: Intron.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Plus
Insertion Point 10585609
Chromosome Band 3R
Flanking Sequence
tttacgcagactatctttctagggTTAAGGAGCTGCTACATTTGATACCACACGATTTTT
TATCGCTGACCAATTTTGGTTTTTTGTGATTTTTTATTTTTAAATAATTGTTGCAATCAA
ATGTAATTACAAATGCATTGAAGCTGTCCGTTTGTGTTTCCTTTTTGCATGGCAATTACA
AAACTAGACAAAAAGCAAAAGCAAGCCAAGAGCTCAATTATTGTTGCAACTTGCAAAAGG
CAGCGGCAACACCAGCCACATCGGCAACAACTGCCGACTGACTGTTGTCGAAttaaccat
tgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE