Detailed Information [142012]
Strain Information
DGRC Number 142012
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL07295 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL07295 bw1 / CyO, S* bw1
Break points/Insertion Site 50F6
Related Genes Arc2 (CG13941), CG10102 (CG10102)
Received Date 11 December 2008
Original Number LL07295
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:10249594(-)
Cytological Band: 50F6
Gene Symbol-1: Arc2
CG Number-1: CG13941
FlyBase ID-1: FBgn0033928
Insertion Type-1: CDS
Gene Symbol-2: CG10102
CG Number-2: CG10102
FlyBase ID-2: FBgn0033927
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Strand Minus
Insertion Point 10249594
Chromosome Band 2R
Flanking Sequence
tttacgcagactatctttctagggTTAATGGTTTCTATGAATATGCGAAACTGTTCGTCG
GACATCTGCGTCATTTTGTTGCCGGTTTCTTGGGTTTGTTTGGGTTTAAAAAATAAGTAA
ACAAGCGCCCAAGCTGAATTCCGATTTCAAGCCCCAATCGTTGGACGGTTGGGGGGCAAC
TGGCGATTTCGCTTGTTGTGAAATGAAAAGCCACATTGCTTTCCTCCCTCTCTCTTTCTC
TGAAAGTAAAAGCTTTTTCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE