Detailed Information [142075]
 

Strain Information
DGRC Number 142075
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL07544 P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; PBac{SAstopDsRed}LL07544 P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 73A11
Related Genes CG17286 (CG17286), CG32165 (CG32165)
Received Date 11 December 2008
Original Number LL07544
Chromosome 3
Comments No Tb expression but Hu is OK. 13Oct2021 E.O.
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:16588426(-)
Cytological Band: 73A11
Gene Symbol-1: CG17286
CG Number-1: CG17286
FlyBase ID-1: FBgn0027500
Insertion Type-1: Putative Promoter
Gene Symbol-2: CG32165
CG Number-2: CG32165
FlyBase ID-2: FBgn0042178
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2021-10-15
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 16588426
Chromosome Band 3L
Flanking Sequence 
tttacgcagactatctttctagggTTAACGAGTGGGGATGTAACGTAAATTTATCTCGCG
CAGTTAATTGGTGACTTGTGTTAACATTTTTCTTTAATATATGTATTTATGTTTTTTTGT
TTATTATATATGTGTATTTATGTTTTTTTGTTTATTGTGGAGTTTTGATATATGCGCTAG
CAGCAGTGATGCAGTAGAATACTAAAAATATTTACATTTTTGACATTTGATCGAAttaac
cattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE