Detailed Information [142147]
 

Strain Information
DGRC Number 142147
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL07851 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL07851 bw1 / CyO, S* bw1
Break points/Insertion Site 43E18
Related Genes CG30382 (CG30382), CG12822 (CG12822)
Received Date 11 December 2008
Original Number LL07851
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:3718767(-)
Cytological Band: 43E18
Gene Symbol-1: CG30382
CG Number-1: CG30382
FlyBase ID-1: FBgn0050382
Insertion Type-1: Intron
Gene Symbol-2: CG12822
CG Number-2: CG12822
FlyBase ID-2: FBgn0033229
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 3718767
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAATTCTTGTTTATCCCGGCGTGATTCGAAttaa
ccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE