| Strain Information | |
|---|---|
| DGRC Number | 103561 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP0224 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | w*; P{w+mW.hs=GawB}NP0224 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 57C7 |
| Map Viewer | ![]() |
| Related Genes | Xpd Pu |
| Original Number | 224 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP0224 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 894 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | weak |
| Larval GFP | sg |
| Larval X-gal | sg, gut |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np05275_0711 |
| Strand | Plus |
| Insertion Point | 16218839 |
| Chromosome Band | 2R |
| Flanking Sequence | tttttgcgtgcactgnaatttanttgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgGTTACAACTAAATCTCAGGCGGTTTAGTCGGCAGATAAA TTCGGAGCGAGCGCGCCAAATACAAAAGTCCGCCACGCGTTCAGAGCCCCAATCTCAAGT CCCAAAGTTCAAACAGTTCCGAGCCCGTGTCCTCGCAGAGTCCACCAATCCCAGCCAAAC ACCAACTCCAATCAATCGAACATGAAGCCCCAGACAAGCGAGCAAAATGGCACTGGCCAA AATGGCGAGGGTGCCGCGGATGCCGTGGCCGTTGCCACgatcgaagaatacataagagag aaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccg acatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatcca acggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtcttt gacctttgntactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatg ttagaggcatatcagtctcactngctnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnn |