| Strain Information | |
|---|---|
| DGRC Number | 103581 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}frc[NP0297] / TM3, Ser[1] |
| Genotype | w*; P{w+mW.hs=GawB}frcNP0297 / TM3, Ser1 |
| Break points/Insertion Site | 74B4; -; 74C2 |
| Map Viewer | ![]() |
| Related Genes | CG32174 CG32176 CG33052 frc |
| Original Number | 297 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}frc[NP0297] NP line. Received from the National Institute of Genetics. |
| Also known as | P{GawB}NP0297 |
| Original Comments | comment1:A, comment2:74C1 |
| Balancer | TM3 Ser |
| Cluster id | 1954 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | muscle subset |
| Larval GFP | weak ubiquitous |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Kanwal A, Joshi PV, Mandal S, Mandal L. Ubx-Collier signaling cascade maintains blood progenitors in the posterior lobes of the Drosophila larval lymph gland. PLoS Genet (2021) 17(8) e1009709 [PubMed ID = 34370733] [RRC reference] Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np39115_0907 |
| Strand | Plus |
| Insertion Point | 17382045 |
| Chromosome Band | 3L |
| Flanking Sequence | gnngggnggngngnnnnnnagtgtgnaaggggtgtttgnttnnnnttttggantnnaccg nnntcntnnnnnctctanngggnctnncggtaaagactcccggctatcgacgggnaccac cttttgttatttcatcatgCCCGGNAACATATGTTCAGTGTGGCCGCAGCAGAGTTGTCA AAACACGCTCCCCAATGAAATAACCTAAATGTGCCATCACTGTTACTTAACAGTTTCTGT TACTTTTCTAGCGGCATGTCAAAAAAACAAAAATATAGAAAATGCTAAATATATATTGGA CTAATGNGTTTAAATGTAACTTACACTAGTAACAgatcgaagaatacataagagagaacc gtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacat gtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgg aattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacc tttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcantgttag aggcatatcagnctccactgaagccatctnnntntnnggnnnnnnnnnnnnnnnnaangg nnnannnncnccnntngnncnatnnntnnanttaannggnnnnnnangnancnnnnnnnc ctnnnntgacnaaaannnnnnnnnnnnnaaanaacnnnnnnnnnnnnnncnngnnnnnnn nnnnnttnnnnnnnnnngaattnnaaaaannnnanncnntncnnnctnnnnnccnanaan aanngnnnnnnnnnnnnnnccannnnnncncanggnnnnnnnnnngnnnnngnnnnnnnn tgnnnnnnaaaaannnnnnnnnnnnnngnnnnnnnnnnnnnnnnaannaannngnnnnaa aannnnnngnnnnnaanggnnnaanaannnnnnnnnngggnnnnnnnannnnncnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Disc |
|
|