| Strain Information | |
|---|---|
| DGRC Number | 103879 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}CG14200[NP1086] / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}CG14200NP1086 / FM7c |
| Break points/Insertion Site | 18C8 |
| Map Viewer | ![]() |
| Related Genes | CG12233 CG14200 Pfrx |
| Original Number | 1086 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP1086 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 452 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | few cells, a small # of cells |
| Larval GFP | sg |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
Benna C, Bonaccorsi S, Wulbeck C, Helfrich-Forster C, Gatti M, Kyriacou CP, Costa R, Sandrelli F. Drosophila timeless2 is required for chromosome stability and circadian photoreception. Curr Biol (2010) 20(4) 346-52 [PubMed ID = 20153199] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np19145_0807 |
| Strand | Minus |
| Insertion Point | 19241355 |
| Chromosome Band | X |
| Flanking Sequence | actttttngngtgcactgaattttnntgtatacttcggtaagcttcggctatcgacggga ccaccttatgttatttcatcatgGTCGAGATGTGGAAGACGAAGAGAGCAAGAAATAGAC TAAGCATGCACGTTCGTGTGGCGCGTCACTTTGGACGCATGTACGTACAATATCGCCAAA TATAAAAAGAAATGACTTACTTTTGCCGCGCTTAATGAACTCCTCCTTGTGCTCGCATTC GAAGGGATAAATAAGCTTCGCGGAACTCACTTGCTCGCTGCGGACAATGAAGAAAGAAAA AGAATAAGAAAAAGCATGTCACGCTAAAGTTGAAATGGGCAAACTCACAAGGTTTTCTCG TTGAAAAACGCCACAACTGCGTACGGCGGGCGCGTGGTGTTGACGAAACGAAAGTCCTGC GACGAGGTCACTTCGCCGGGCCACCAgatcgaagaatacataagagagaaccgtcgccaa agaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcct cttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgg agttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgtta ctactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcata tcagtctccnctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnn |