| Strain Information | |
|---|---|
| DGRC Number | 103970 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Ama[NP1297] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}AmaNP1297 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 84A5 |
| Map Viewer | ![]() |
| Related Genes | bcd Dfd Ama |
| Original Number | 1297 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP1297 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 1362 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | cns + pns subset (SG) |
| Larval GFP | sg |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
Zappia MP, de Castro L, Ariss MM, Jefferson H, Islam AB, Frolov MV. A cell atlas of adult muscle precursors uncovers early events in fibre-type divergence in Drosophila. EMBO Rep (2020) 21(10) e49555 [PubMed ID = 32815271] [RRC reference] Ariss MM, Terry AR, Islam ABMMK, Hay N, Frolov MV. Amalgam regulates the receptor tyrosine kinase pathway through Sprouty in glial cell development in the Drosophila larval brain. J Cell Sci (2020) 133(19) [PubMed ID = 32878945] [RRC reference] Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np17695_0807 |
| Strand | Plus |
| Insertion Point | 2589157 |
| Chromosome Band | 3R |
| Flanking Sequence | actnttttgngtgcactgactttatntgtatacttcggtaagcttcggctatcgacggga ccaccttatgttatttcatcatgCATTGAACCCACATTGAACTGAGAGATAGTCGAGGAA AAAGAGTCACAAAATCAACAGCAACATCCTGTAAATAAACAGAAATGTATGAATTATATT AAAATAAGACGATAAAGCTGAAAAGTGTGTACAAGCCTTAAAAATGTTTCAAAACGAGTG TGTGTGCAGAATTCTTTCCTTCTTATTTACTTTTGAAAGATACTTTTAAAGATATACTTG TGACCTTTAAATTATTATTCTATAATTGAACCTAGTTTTAGTTTATTATATTGAATTCGA AGATGGGTTAAAAATGGCAGTTCTCCATTACATACGAAATATTTAGAATGGCTAACGCga tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtttt caggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagc atccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaat cgatacagtcaactgtctttgaccctttggtactactctcttccgatgatgatgtcgcac ttattctatgctgtctcaatgttagaggcatatcagtctccactgacatnnnnnnnnnnn gggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnn |