| Strain Information | |
|---|---|
| DGRC Number | 104055 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP1624 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP1624 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 37E2; -; 37E3 |
| Map Viewer | ![]() |
| Related Genes | CG10026 CG10034 |
| Original Number | 1624 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP1624 NP line. Received from the National Institute of Genetics. |
| Also known as | tj-GAL4, tj-Gal4, traffic jam-Gal4, traffic jam-GAL4 |
| Balancer | CyUW14 |
| Cluster id | 1243 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | sg |
| Larval GFP | sg |
| Larval X-gal | sg |
| Adult GFP | weak |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Richens JH, Dmitrieva M, Zenner HL, Muschalik N, Butler R, Glashauser J, Camelo C, Luschnig S, Munro S, Rittscher J, St Johnston D. MSP-tracker: A versatile vesicle tracking software tool used to reveal the spatial control of polarized secretion in Drosophila epithelial cells. PLoS Biol (2025) 23(4) e3003099 [PubMed ID = 40208901] [RRC reference] Alizada A, Martins A, Mouniee N, Rodriguez Suarez JV, Bertin B, Gueguen N, Mirouse V, Papameletiou AM, Rivera AJ, Lau NC, Akkouche A, Maupetit-Mehouas S, Hannon GJ, Czech Nicholson B, Brasset E. The transcription factor Traffic jam orchestrates the somatic piRNA pathway in Drosophila ovaries. Cell Rep (2025) 115453 [PubMed ID = 40209715] [RRC reference] Houston BJ, Nguyen J, Burke R, Nogueira Alves A, Hime GR, O'Bryan MK. Mammalian heat shock protein A4 family ortholog Hsc70Cb is required for two phases of spermatogenesis in D. melanogaster. Reproduction (2025) 169(4) [PubMed ID = 39991973] [RRC reference] Chen P, Pan KC, Park EH, Luo Y, Lee YCG, Aravin AA. Escalation of genome defense capacity enables control of an expanding meiotic driver. Proc Natl Acad Sci U S A (2025) 122(2) e2418541122 [PubMed ID = 39772737] [RRC reference] Kline BL, Siddall NA, Wijaya F, Stuart CJ, Orlando L, Bakhshalizadeh S, Afkhami F, Bell KM, Jaillard S, Robevska G, van den Bergen JA, Shahbazi S, van Hoof A, Ayers KL, Hime GR, Sinclair AH, Tucker EJ. Functional characterization of human recessive DIS3 variants in premature ovarian insufficiency†. Biol Reprod (2025) 112(1) 102-118 [PubMed ID = 39400047] [RRC reference] Goncalves M, Lopes C, Alegot H, Osswald M, Bosveld F, Ramos C, Richard G, Bellaiche Y, Mirouse V, Morais-de-Sa E. The Dystrophin-Dystroglycan complex ensures cytokinesis efficiency in Drosophila epithelia. EMBO Rep (2025) 26(2) 307-328 [PubMed ID = 39548266] [RRC reference] Kwok SH, Liu Y, Bilder D, Kim J. Paraneoplastic renal dysfunction in fly cancer models driven by inflammatory activation of stem cells. Proc Natl Acad Sci U S A (2024) 121(42) e2405860121 [PubMed ID = 39392665] [RRC reference] He L, Sun F, Wu Y, Li Z, Fu Y, Huang Q, Li J, Wang Z, Cai J, Feng C, Deng X, Gu H, He X, Yu J, Sun F. L(1)10Bb serves as a conservative determinant for soma-germline communications via cellular non-autonomous effects within the testicular stem cell niche. Mol Cell Endocrinol (2024) 591 112278 [PubMed ID = 38795826] [RRC reference] Martin-Diaz J, Herrera SC. A stem cell activation state coupling spermatogenesis with social interactions in Drosophila males. Cell Rep (2024) 43(8) 114647 [PubMed ID = 39153199] [RRC reference] Xu F, Suyama R, Inada T, Kawaguchi S, Kai T. HemK2 functions for sufficient protein synthesis and RNA stability through eRF1 methylation during Drosophila oogenesis. Development (2024) 151(14) [PubMed ID = 38881530] [RRC reference] Chatterjee P, Mukherjee S, Majumder P. Shaping Drosophila eggs: unveiling the roles of Arpc1 and cpb in morphogenesis. Funct Integr Genomics (2024) 24(4) 120 [PubMed ID = 38960936] [RRC reference] Roach TV, Lenhart KF. Mating-induced Ecdysone in the testis disrupts soma-germline contacts and stem cell cytokinesis. Development (2024) 151(11) [PubMed ID = 38832826] [RRC reference] Mallart C, Netter S, Chalvet F, Claret S, Guichet A, Montagne J, Pret AM, Malartre M. JAK-STAT-dependent contact between follicle cells and the oocyte controls Drosophila anterior-posterior polarity and germline development. Nat Commun (2024) 15(1) 1627 [PubMed ID = 38388656] [RRC reference] Taniguchi K, Igaki T. Sas-Ptp10D shapes germ-line stem cell niche by facilitating JNK-mediated apoptosis. PLoS Genet (2023) 19(3) e1010684 [PubMed ID = 36972315] [RRC reference] Nguyen TTM, Munkhzul C, Kim J, Kyoung Y, Vianney M, Shin S, Ju S, Pham-Bui HA, Kim J, Kim JS, Lee M. In vivo profiling of the Zucchini proximal proteome in the Drosophila ovary. Development (2023) 150(4) [PubMed ID = 36762624] [RRC reference] Ku HY, Harris LK, Bilder D. Specialized cells that sense tissue mechanics to regulate Drosophila morphogenesis. Dev Cell (2023) 58(3) 211-223.e5 [PubMed ID = 36708706] [RRC reference] Chatterjee D, Cong F, Wang XF, Machado Costa CA, Huang YC, Deng WM. Cell polarity opposes Jak/STAT-mediated Escargot activation that drives intratumor heterogeneity in a Drosophila tumor model. Cell Rep (2023) 42(2) 112061 [PubMed ID = 36709425] [RRC reference] Chatterjee D, Costa CAM, Wang XF, Jevitt A, Huang YC, Deng WM. Single-cell transcriptomics identifies Keap1-Nrf2 regulated collective invasion in a Drosophila tumor model. Elife (2022) 11 [PubMed ID = 36321803] [RRC reference] Osswald M, Barros-Carvalho A, Carmo AM, Loyer N, Gracio PC, Sunkel CE, Homem CCF, Januschke J, Morais-de-Sa E. aPKC regulates apical constriction to prevent tissue rupture in the Drosophila follicular epithelium. Curr Biol (2022) 32(20) 4411-4427.e8 [PubMed ID = 36113470] [RRC reference] Yuen AC, Prasad AR, Fernandes VM, Amoyel M. A kinase translocation reporter reveals real-time dynamics of ERK activity in Drosophila. Biol Open (2022) 11(5) [PubMed ID = 35608229] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np26025_0807 |
| Strand | Plus |
| Insertion Point | 19442138 |
| Chromosome Band | 2L |
| Flanking Sequence | gtnangtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc ttatgttatttcatcatgCCTCGCACCAAAAGCAAAAGCATCAGCGAATGGCGTTCGAGC TCGGTTTTGTTTGTTGTTGGGCTGGTCGGCTTTTTGGTTTTGGCAAGTCGTTTTGTTTGT CGGCTGTTGGGAAAAGGAATGGGTGTGTGTGTGTGGGTGTGCGCGCGCTGCGCTGCCATT CTAACAGTTATCATCAAGGGAACAGAGCATCCAGAGCAGAGCTTCCAGAGCAGAGCCACC CTCCAGTCAGATTCAGTCCGACCTTAGTTGAAACGGACACGGAGTTCAGTCGCCACCGTT AACTCTTTCACATTGGACGCGAAAAGCGCGTTCGCGAAATTAGTGAGCAAAATTGGAAAG AGAGCGAGCTTACAAATGAATTAAGCGCCAAAGTGCGGATAGTgatcgaagaatacataa gagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc atccgacatgtcatnctcttcagaccaatcaaatccatgaagagcatncctgggcataaa atccaacgggaattgnggagttatcatgatgagctgncgagtcaatcgatacagtcaact gtctttgacctttggtactactctcttccgatgatgatgtcgcacttattctatgctgtc tcaatggtagaggcatatcagtctcctncccnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |