Detailed Information [104055]
 

Strain Information
DGRC Number 104055
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1624 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1624 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 37E2; -; 37E3
Map Viewer
Related Genes CG10026 CG10034
Original Number 1624
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1624

NP line. Received from the National Institute of Genetics.

Also known as tj-GAL4, tj-Gal4, traffic jam-Gal4, traffic jam-GAL4
Balancer CyUW14
Cluster id 1243
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP weak
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2026-08-04
Research papers using this strain
[Please submit your publication]
Kline BL, Moran IL, Cai X, Siddall NA, Wijaya F, Dulon J, Bakhshalizadeh S, Bell KM, Jaillard S, Robevska G, van den Bergen JA, Touraine P, Ayers KL, Hime GR, Sinclair AH, Tucker EJ.
RNA exosome component EXOSC10 variants identified in a patient with premature ovarian insufficiency†.
Biol Reprod (2026) 114(4) 1416-1428 [PubMed ID = 41609100] [RRC reference]

Matsui M, Kawaguchi S, Kai T.
Transcriptional repression of reaper by Stand still ensures female germline development in Drosophila.
PLoS Genet (2026) 22(3) e1012041 [PubMed ID = 41785206] [RRC reference]

Veitia RA, Herman L, Legois B, Claret S, Zider A, Todeschini AL.
Deciphering the Impact of AKT1 Pathogenic Variants in Juvenile Granulosa Cell Tumors Using a Drosophila Model.
Mol Cell Proteomics (2025) 24(12) 101466 [PubMed ID = 41237900] [RRC reference]

Almeida Machado Costa C, Santiago-Santiago CA, Huang YC, Deng WM.
Single-cell transcriptomics reveals stepwise transformation of epithelial cells into Non-Professional Phagocytes.
PLoS Genet (2025) 21(12) e1011953 [PubMed ID = 41343490] [RRC reference]

Wang Y, Lv P, Li Y, Yang X, Du J.
Tissue-specific CLOCK isoforms modulate circadian feedback loops to govern reproductive fitness in?Drosophila.
Cell Mol Life Sci (2025) 82(1) 398 [PubMed ID = 41231295] [RRC reference]

Huang YC, Almeida Machado Costa C, Vergara Ruiz N, Wang X, Jevitt A, Breneman CM, Han C, Deng WM.
Polyploidy promotes transformation of epithelial cells into nonprofessional phagocytes.
Proc Natl Acad Sci U S A (2025) 122(30) e2427293122 [PubMed ID = 40694325] [RRC reference]

Richens JH, Dmitrieva M, Zenner HL, Muschalik N, Butler R, Glashauser J, Camelo C, Luschnig S, Munro S, Rittscher J, St Johnston D.
MSP-tracker: A versatile vesicle tracking software tool used to reveal the spatial control of polarized secretion in Drosophila epithelial cells.
PLoS Biol (2025) 23(4) e3003099 [PubMed ID = 40208901] [RRC reference]

Alizada A, Martins A, Mouniee N, Rodriguez Suarez JV, Bertin B, Gueguen N, Mirouse V, Papameletiou AM, Rivera AJ, Lau NC, Akkouche A, Maupetit-Mehouas S, Hannon GJ, Czech Nicholson B, Brasset E.
The transcription factor Traffic jam orchestrates the somatic piRNA pathway in Drosophila ovaries.
Cell Rep (2025) 115453 [PubMed ID = 40209715] [RRC reference]

Houston BJ, Nguyen J, Burke R, Nogueira Alves A, Hime GR, O'Bryan MK.
Mammalian heat shock protein A4 family ortholog Hsc70Cb is required for two phases of spermatogenesis in D. melanogaster.
Reproduction (2025) 169(4) [PubMed ID = 39991973] [RRC reference]

Chen P, Pan KC, Park EH, Luo Y, Lee YCG, Aravin AA.
Escalation of genome defense capacity enables control of an expanding meiotic driver.
Proc Natl Acad Sci U S A (2025) 122(2) e2418541122 [PubMed ID = 39772737] [RRC reference]

Kline BL, Siddall NA, Wijaya F, Stuart CJ, Orlando L, Bakhshalizadeh S, Afkhami F, Bell KM, Jaillard S, Robevska G, van den Bergen JA, Shahbazi S, van Hoof A, Ayers KL, Hime GR, Sinclair AH, Tucker EJ.
Functional characterization of human recessive DIS3 variants in premature ovarian insufficiency†.
Biol Reprod (2025) 112(1) 102-118 [PubMed ID = 39400047] [RRC reference]

Goncalves M, Lopes C, Alegot H, Osswald M, Bosveld F, Ramos C, Richard G, Bellaiche Y, Mirouse V, Morais-de-Sa E.
The Dystrophin-Dystroglycan complex ensures cytokinesis efficiency in Drosophila epithelia.
EMBO Rep (2025) 26(2) 307-328 [PubMed ID = 39548266] [RRC reference]

Kwok SH, Liu Y, Bilder D, Kim J.
Paraneoplastic renal dysfunction in fly cancer models driven by inflammatory activation of stem cells.
Proc Natl Acad Sci U S A (2024) 121(42) e2405860121 [PubMed ID = 39392665] [RRC reference]

He L, Sun F, Wu Y, Li Z, Fu Y, Huang Q, Li J, Wang Z, Cai J, Feng C, Deng X, Gu H, He X, Yu J, Sun F.
L(1)10Bb serves as a conservative determinant for soma-germline communications via cellular non-autonomous effects within the testicular stem cell niche.
Mol Cell Endocrinol (2024) 591 112278 [PubMed ID = 38795826] [RRC reference]

Martin-Diaz J, Herrera SC.
A stem cell activation state coupling spermatogenesis with social interactions in Drosophila males.
Cell Rep (2024) 43(8) 114647 [PubMed ID = 39153199] [RRC reference]

Xu F, Suyama R, Inada T, Kawaguchi S, Kai T.
HemK2 functions for sufficient protein synthesis and RNA stability through eRF1 methylation during Drosophila oogenesis.
Development (2024) 151(14) [PubMed ID = 38881530] [RRC reference]

Chatterjee P, Mukherjee S, Majumder P.
Shaping Drosophila eggs: unveiling the roles of Arpc1 and cpb in morphogenesis.
Funct Integr Genomics (2024) 24(4) 120 [PubMed ID = 38960936] [RRC reference]

Roach TV, Lenhart KF.
Mating-induced Ecdysone in the testis disrupts soma-germline contacts and stem cell cytokinesis.
Development (2024) 151(11) [PubMed ID = 38832826] [RRC reference]

Mallart C, Netter S, Chalvet F, Claret S, Guichet A, Montagne J, Pret AM, Malartre M.
JAK-STAT-dependent contact between follicle cells and the oocyte controls Drosophila anterior-posterior polarity and germline development.
Nat Commun (2024) 15(1) 1627 [PubMed ID = 38388656] [RRC reference]

Taniguchi K, Igaki T.
Sas-Ptp10D shapes germ-line stem cell niche by facilitating JNK-mediated apoptosis.
PLoS Genet (2023) 19(3) e1010684 [PubMed ID = 36972315] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26025_0807
Strand Plus
Insertion Point 19442138
Chromosome Band 2L
Flanking Sequence
gtnangtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgCCTCGCACCAAAAGCAAAAGCATCAGCGAATGGCGTTCGAGC
TCGGTTTTGTTTGTTGTTGGGCTGGTCGGCTTTTTGGTTTTGGCAAGTCGTTTTGTTTGT
CGGCTGTTGGGAAAAGGAATGGGTGTGTGTGTGTGGGTGTGCGCGCGCTGCGCTGCCATT
CTAACAGTTATCATCAAGGGAACAGAGCATCCAGAGCAGAGCTTCCAGAGCAGAGCCACC
CTCCAGTCAGATTCAGTCCGACCTTAGTTGAAACGGACACGGAGTTCAGTCGCCACCGTT
AACTCTTTCACATTGGACGCGAAAAGCGCGTTCGCGAAATTAGTGAGCAAAATTGGAAAG
AGAGCGAGCTTACAAATGAATTAAGCGCCAAAGTGCGGATAGTgatcgaagaatacataa
gagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc
atccgacatgtcatnctcttcagaccaatcaaatccatgaagagcatncctgggcataaa
atccaacgggaattgnggagttatcatgatgagctgncgagtcaatcgatacagtcaact
gtctttgacctttggtactactctcttccgatgatgatgtcgcacttattctatgctgtc
tcaatggtagaggcatatcagtctcctncccnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE