| Strain Information | |
|---|---|
| DGRC Number | 104096 |
| Genotype with FlyBase Link | y[*] P{w[+mW.hs]=GawB}CG3777[NP2119] w[*] / FM7c |
| Genotype | y* P{w+mW.hs=GawB}CG3777NP2119 w* / FM7c |
| Break points/Insertion Site | 1A3; -; 1A4 |
| Map Viewer | ![]() |
| Related Genes | CG32816 EG:125H10.1 |
| Original Number | 2119 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP2119 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 6 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | tracheal cells? |
| Larval GFP | epi, tr |
| Larval X-gal | tr, epi, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y. Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory. Proc Natl Acad Sci U S A (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np28335_0807 |
| Strand | Minus |
| Insertion Point | 100303 |
| Chromosome Band | X |
| Flanking Sequence | antttnggggnaaaaacccnanttttatncttcggtaagcttcggctatcgacgggacca ccttatgttatttcatcatgGGCAGGAGTGACGATACAGTATGTACATATATATATATAT ATGTTCACTTTTTNTGTTATGACCNTGCTAAAACTAAATCATTTACACCTGCAGTCgatc gaagaatacataagagagaaccgtcgccaaagaacccattttttttgggggcccgttttc aggaagggcaagccctcccgacatgttatcctctttcagaccaaatcaaatccatgaaga gcatccctgggcataaaaaccnacgggattgggggagttatcatgatgagctgnccgagt caaatcgatacagncaactggtctttgacccttggtnccactctcttcccgaganggatg gtcgcacttttttctatgctgtctcaatgttagaggcatatcagtctccactgagcatct tttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaann |