| Strain Information | |
|---|---|
| DGRC Number | 104116 |
| Genotype with FlyBase Link | P{w[+mW.hs]=GawB}CG3835[NP2179] w[*] / FM7c |
| Genotype | P{w+mW.hs=GawB}CG3835NP2179 w* / FM7c |
| Break points/Insertion Site | 2D4 |
| Map Viewer | ![]() |
| Related Genes | ph-p EG:87B1.3 |
| Original Number | 2179 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP2179 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 61 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | sg |
| Larval GFP | fb |
| Larval X-gal | epi, fb, mt, gut |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2025-02-18 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np27705_0807 |
| Strand | Plus |
| Insertion Point | 1898457 |
| Chromosome Band | X |
| Flanking Sequence | atttttcgtgcctgaatttaattgtatacttcggtaagcttcggctatcgacgggaccac cttatgttatttcatcatgATTGAGAGATTCTGGCGCGTGAGGCTCTCCCATTCCCGGTT ACTTGTCGTGTGTTAGTGAATGAGgatcgaagaatacataagagagaaccgtcgccaaag aacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctct tcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggag ttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttacta ctctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatca gtctccactgagctctttttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Disc |
|
|