| Strain Information | |
|---|---|
| DGRC Number | 104121 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG31176[NP2190] / TM3, Sb[1] Ser[1] |
| Genotype | w*; P{w+mW.hs=GawB}CG31176NP2190 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 93F1 |
| Map Viewer | ![]() |
| Related Genes | CG31176 CG5849 DNApol-alpha180 |
| Original Number | 2190 |
| Chromosome | 3 |
| Comments | Ser seems to be suppressed or lost. 2007-11-12 NJ NP line. Received from the National Institute of Genetics. |
| Balancer | TM3 Sb Ser |
| Cluster id | 1582 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | foregut (SG) |
| Larval GFP | tr |
| Larval X-gal | sg, hg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A. Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster. J Comp Neurol (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np27765_0807 |
| Strand | Plus |
| Insertion Point | 17536339 |
| Chromosome Band | 3R |
| Flanking Sequence | nggggnagggggtgtnngtttnttgggngactnacgnngngtaanaaacncatccttggg gggcggaaagannccggctatcgacgggaccaccttatgttatttcatcatgGACTGTGG AGTGCGAGTCGGAAACGGAATTAACTTGGTTCGCTCTGTTATCGCCATGTTAAGTAACAT TCGTTAACATTTACCAACGGAAAGAGCAAAAGCTTCgatcgaagaatacataagagagaa ccgtcgccaaagaacccattattgntggggtccgttttnaggnggggcaagccatccgac atgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaac ggaattgnggagttatcatgatgagctgccgagtcaatcgatacagncaactgtctttga ccttngntactactctcttccgatgatgangtcgcacttattctatgctgnctcaatgtt agaggcatatcagnctccactgaagccatnnnantnnggnnnnnnnnnnnggnngnnnnn nnnnnngnnngnggggngngnnnnngnnagnnnnngngngnnnnnngnngggnggnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagnnnnnnnnnnnn agnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnan |