| Strain Information | |
|---|---|
| DGRC Number | 104198 |
| Genotype with FlyBase Link | w[*] P{w[+mW.hs]=GawB}Sxl[NP2426] / FM7c |
| Genotype | w* P{w+mW.hs=GawB}SxlNP2426 / FM7c |
| Break points/Insertion Site | 6F5 |
| Map Viewer | ![]() |
| Related Genes | CG33070 CG4615 |
| Original Number | 2426 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP2426 NP line. Received from the National Institute of Genetics. |
| Also known as | LN2-GAL4 |
| Balancer | FM7c |
| Cluster id | 197 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | epi stripe |
| Larval GFP | weak |
| Larval X-gal | sg |
| Adult GFP | abdomen |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-05-21 |
| Research papers using this strain [Please submit your publication] |
Rozenfeld E, Lerner H, Parnas M. Muscarinic Modulation of Antennal Lobe GABAergic Local Neurons Shapes Odor Coding and Behavior. Cell Rep (2019) 29(10) 3253-3265.e4 [PubMed ID = 31801087] [RRC reference] Brown EB, Rayens E, Rollmann SM. The Gene CG6767 Affects Olfactory Behavior in Drosophila melanogaster. Behav Genet (2019) 49(3) 317-326 [PubMed ID = 30710192] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np21655_0807 |
| Strand | Minus |
| Insertion Point | 6836504 |
| Chromosome Band | X |
| Flanking Sequence | attttgggnaaaaacccttttttgtatacttcggtaagcttcggctatcgacgggacccc ttatgttatttcatcatgGGTGAGGAGAGGGCAGCTGCATTTATTTCCTTTTCTCTTCAT CTCCGCTTCTCGGTGGGTCATTCCCCTTCTTGCTGTTGGCAATGACGTCGCATCGCAACg atcgaagaatacataagagagaaccgtcgccaaagaanncattattgttggggtccgttt tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag catccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaa tcgatacagncaactggctttgacctttggtactactctctttcgangatgangncgcac ttattctatgctggctcaatggtagaggcatatcagtctccactgaagcatnttnttttt ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnn |