| Strain Information | |
|---|---|
| DGRC Number | 104223 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}Trf4-2[NP2505] / TM3, Sb[1] Ser[1] |
| Genotype | w*; P{w+mW.hs=GawB}Trf4-2NP2505 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 96B9 |
| Map Viewer | ![]() |
| Related Genes | CG11120 CG17462 Doc{}1419 |
| Original Number | 2505 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}Trf4-2[NP2505] NP line. Received from the National Institute of Genetics. |
| Also known as | P{GawB}NP2505 |
| Balancer | TM3 Sb Ser |
| Cluster id | 1631 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | sg |
| Larval GFP | sg |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Nakamura R, Takeuchi R, Takata K, Shimanouchi K, Abe Y, Kanai Y, Ruike T, Ihara A, Sakaguchi K. TRF4 is involved in polyadenylation of snRNAs in Drosophila melanogaster. Mol Cell Biol (2008) 28(21) 6620-31 [PubMed ID = 18765642] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np23655_0807 |
| Strand | Plus |
| Insertion Point | 20741832 |
| Chromosome Band | 3R |
| Flanking Sequence | tttttnnnnactntnnttggggtgananagccatttttttgnatacttcggtaagcttcg gctatcgacgggaccaccttatgttatttcatcatgATTCGCGTTTTACAGATTCCTTCG TTTCTCGTCCGTATTCTTCTTTCTATCTCCGTCACACTTATATTTTTCTTTCTCTCAATT CCTTTTTCGCGTAAAGCAATACGCGGGACGCAAAATGTGTGACGAAGCGAATCCATNNAA GCCGTGGCAGCTTCCCGATGTGGTGTACGGCAATGGGATTCCGGCGCTGTGCCTGCTGCA CCAGGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggg gtcccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg ccgagtcaatcgatacagtcaactgtctttgacctttgtactactctcttccgatgatga tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnt tttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Disc |
|
|