Detailed Information [104266]
 

Strain Information
DGRC Number 104266
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2631 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2631 / CyO
Break points/Insertion Site 44A3
Map Viewer
Related Genes Optix FB{}773
Original Number 2631
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2631

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 585
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression cns, anterior terminal
Larval GFP head skelton
Larval X-gal anteriorend of wing pouch, oscelli?
Adult GFP pupal wing margin, mouth, eye
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2026-08-04
Research papers using this strain
[Please submit your publication]
Sato K, Ahsan MT, Ote M, Koganezawa M, Yamamoto D.
Calmodulin-binding transcription factor shapes the male courtship song in Drosophila.
PLoS Genet (2019) 15(7) e1008309 [PubMed ID = 31344027] [RRC reference]

Bielopolski N, Amin H, Apostolopoulou AA, Rozenfeld E, Lerner H, Huetteroth W, Lin AC, Parnas M.
Inhibitory muscarinic acetylcholine receptors enhance aversive olfactory learning in adult Drosophila.
Elife (2019) 8 [PubMed ID = 31215865] [RRC reference]

Suzuki T, Hasegawa E, Nakai Y, Kaido M, Takayama R, Sato M.
Formation of Neuronal Circuits by Interactions between Neuronal Populations Derived from Different Origins in the Drosophila Visual Center.
Cell Rep (2016) 15(3) 499-509 [PubMed ID = 27068458] [RRC reference]

Suzuki T, Takayama R, Sato M.
eyeless/Pax6 controls the production of glial cells in the visual center of Drosophila melanogaster.
Dev Biol (2016) 409(2) 343-53 [PubMed ID = 26670857] [RRC reference]

Lin AC, Bygrave AM, de Calignon A, Lee T, Miesenbock G.
Sparse, decorrelated odor coding in the mushroom body enhances learned odor discrimination.
Nat Neurosci (2014) 17(4) 559-68 [PubMed ID = 24561998] [RRC reference]

Coen P, Clemens J, Weinstein AJ, Pacheco DA, Deng Y, Murthy M.
Dynamic sensory cues shape song structure in Drosophila.
Nature (2014) 507(7491) 233-7 [PubMed ID = 24598544] [RRC reference]

von Philipsborn AC, Jorchel S, Tirian L, Demir E, Morita T, Stern DL, Dickson BJ.
Cellular and behavioral functions of fruitless isoforms in Drosophila courtship.
Curr Biol (2014) 24(3) 242-51 [PubMed ID = 24440391] [RRC reference]

Wu Y, Ren Q, Li H, Guo A.
The GABAergic anterior paired lateral neurons facilitate olfactory reversal learning in Drosophila.
Learn Mem (2012) 19(10) 478-86 [PubMed ID = 22988290] [RRC reference]

Ren Q, Li H, Wu Y, Ren J, Guo A.
A GABAergic inhibitory neural circuit regulates visual reversal learning in Drosophila.
J Neurosci (2012) 32(34) 11524-38 [PubMed ID = 22915099] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23435_0807
Strand Plus
Insertion Point 3090605
Chromosome Band 2R
Flanking Sequence
CNTNNNTTGTTACTTCGGTAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGC
TACTGACAGCGCCACAATAAAAACTTTTGCTCGTGAATATTTTGCCCCATTCGACGGGGC
ATAAATCAAAAGTTCCCTTTTGCCAAAATGAAAACGTGATTTTCTCCTTGGTCATATATA
TGTGCATATAAATGGCGGATGAGAGGGCTGGAGGGTCGTCCTGGCCCAAGGGTNTGGCTT
ACCGGGAGCGAAGAGTTGGGGCTTCANAAAGGGGGAAATGGCATGGGAAGGAAAAGGGCN
AGANGAAGGANCCGCGGCNGANGTTGGCNGACCNNCTGGNGGNAAACATTTTGCTTCCCT
TANTCCATNTNNTTCACTTACCGGGGNGNCNAATCCATGGAAAGGCGGTTCGAGAATTCC
TTAGGNAGGACCCGCNGCCAAGNACCCAATNTTGGTGGGGNTCCGTTTCAAGGAAGGGCA
GGCCTTCNNCNTTGTATTCCTTTTNAAACCATTCAATTCCTTGAGGNGCNTCCTTGGCCN
TAAANTCCACCGGANTTGGGGNGTTTTNATGAGGGCCTGCCAGTNATTCGTTCCAGCCAC
CTGNCTTGACCTTGGTACTACTTTNTTCCAAGATGATGNCCACTTATCTATGCTGNCTCA
TGGTAGAGGCATATCAGTCTCCTNCTCCNTTTTTNNGNGGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)

CLOSE