| Strain Information | |
|---|---|
| DGRC Number | 104412 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}foxo[NP3205] |
| Genotype | w*; P{w+mW.hs=GawB}foxoNP3205 |
| Break points/Insertion Site | 88A5 |
| Map Viewer |  |
| Related Genes | foxo CG3153 CR31476 |
| Original Number | 3205 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP3205 NP line. Received from the National Institute of Genetics. |
| Original Comments | comment1:A, comment2:88A8-A10 |
| Cluster id | 1479 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | sg |
| Larval X-gal | epi, fb, mt, tr |
| Adult GFP | abd |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Wagner C, Uliczka K, Bossen J, Niu X, Fink C, Thiedmann M, Knop M, Vock C, Abdelsadik A, Zissler UM, Isermann K, Garn H, Pieper M, Wegmann M, Koczulla AR, Vogelmeier CF, Schmidt-Weber CB, Fehrenbach H, Konig P, Silverman N, Renz H, Pfefferle P, Heine H, Roeder T. Constitutive immune activity promotes JNK- and FoxO-dependent remodeling of Drosophila airways. Cell Rep (2021) 35(1) 108956 [PubMed ID = 33826881] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np35745_0907 |
| Strand | Plus |
| Insertion Point | 9883000 |
| Chromosome Band | 3R |
| Flanking Sequence | atctttnggtgcactganctttntttgtntacttcggtaagcttcggctatcgacgggca ccaccttntgttatttcatcatgCATACGACAATCGTATAAAATAAGAGAAAAGCTCCAA AACGTATTAAATAGCGATGCTTGGATgatcgaagaatacataagagagaaccgtcgccaa agaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcct cttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgg agttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttggtac tacttcttntttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagnnnnnnn nnnnnnnagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnntn tnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnntnnnnnnnnnnnnnnnnntttnnnnncnnnnnnnnnnnnnntnnntntnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnntnnnnnnnntnntnt tnnnttnntnntnnnnnttnnaanan |