| Strain Information | |
|---|---|
| DGRC Number | 104471 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}NP3362 / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}NP3362 / FM7c |
| Break points/Insertion Site | 15A1 |
| Map Viewer |  |
| Related Genes | CG13010 CG13012 |
| Original Number | 3362 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP3362 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 394 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | weak sg |
| Larval GFP | gut |
| Larval X-gal | gut |
| Adult GFP | joint in leg, mouth. hinge, antenna, sternite, weaker in pleura. oceli. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-02-01 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np14365_0727 |
| Strand | Plus |
| Insertion Point | 16404080 |
| Chromosome Band | X |
| Flanking Sequence | antacttggggcactgaacctattttttatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgGCCCAAACGTAACTTTCGATTGCGCCAAAAGCGGCGGC TGCGACGCCGACTGCGCAGTCGCGAGAATGTCGAGAAAGGCGGCTTAACCCTATAAAGGC CAAACACTTTGTTTTGGGCCAATTTAGGAACATGAAAATGANTGCAGTTAgatcgaagaa tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag tcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctat gctgtctcaatgttagaggcatatcagtctccactgaagccatcttntttttggggnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |