| Strain Information | |
|---|---|
| DGRC Number | 104498 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG3308[NP3425] |
| Genotype | w*; P{w+mW.hs=GawB}CG3308NP3425 |
| Break points/Insertion Site | 93D2 |
| Map Viewer | ![]() |
| Related Genes | CG3301 CG3308 CG5919 |
| Original Number | 3425 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP3425 NP line. Received from the National Institute of Genetics. |
| Cluster id | 1575 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | muscle |
| Larval GFP | ubiquitous epi |
| Larval X-gal | stripe in epi, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-06-27 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np11115_0727 |
| Strand | Plus |
| Insertion Point | 17099536 |
| Chromosome Band | 3R |
| Flanking Sequence | anttacctggggtgcactgcccnttncntntntacttncggtaagncttcggctatcgac gggnaccaccttatgttatttcatcatgCTAGAGTTGAACAACGTCTGCAGAACGGGTCA GTGCAGGTACTACACTCTGCATGCAATCGATAGTCGGAATCGATACGTAGCACCAAATTA TATCGTGTTTGAATTTAAATTGTTATCAAAATAAATATTATGTAATAANNTTCAGTCCAA TTATTTGATATAAATATATTTGTTTCATGTATATAGTAGAATTCCgatcgaagaatacat nagagagaaccgtcgccaaagaacccattnttgttggggtccgtnttcaggaagggcaag ccatccgacatgtcatcctcttcagaccaatcaantncatgangagcatccntgggcata aaatccaacngaatngnggngttatnatgatgagctgccgantcantcgntacagacaac tgtntttgacctttgttactactctcttccgatgatgatgtcncacttattctatgctgg ctcaatggtagaggcatatcagtctccactgagctcnnnnnnnnngggggngggnnnntt ttttttnaannaanaaacaaanggtttaaaacangttccccccacgggntngntagggga ggggnaatatgatattgcaccngnnntnaatncctntattntnagnttggggnatgccng gggttccatgccnctggnttntttacgnntcnacaatgggnnngcnnagctctanggggg aaactnntttnanaaacacatccancntnntnnttncnanaggnntttntnttgngnncc cnggngnnaacnntngnngnagactttnnaannnctccngggcanggnntnnaaanggnn tnnnnnnnnnnnnnaannnnnnnnnnancnnnncaananccntttggng |