| Strain Information | |
|---|---|
| DGRC Number | 104529 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP3518 |
| Genotype | w*; P{w+mW.hs=GawB}NP3518 |
| Original Number | 3518 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP3518 NP line. Received from the National Institute of Genetics. |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | AS. leading edge (TU) may be a useful driver (SH). |
| Larval GFP | tr pit, asp, psp |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np13155_0727 |
| Flanking Sequence | antntctttggggtgaaaaagccctttattttgtatacttncggtaagncttcggctatc gacgggaccaccttatgttatttcatcatgCCTGCGCTCAAAGGCGCACACACACAGGCG CACGCACACAGGCGTACGGCCGAAGGCGGCCGACGCgatcgaagaatacataagagagaa ccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcatttccatccga catgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaa cggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttg acctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgt tagaggcatatcagtctccactgagcattttntttnnggggnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnn |