| Strain Information | |
|---|---|
| DGRC Number | 104569 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}NetA[NP4012] / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}NetANP4012 / FM7c |
| Break points/Insertion Site | 12F2 |
| Map Viewer | ![]() |
| Related Genes | NetA CG5321 I-element{}129 |
| Original Number | 4012 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP4012 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 339 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | ventral epi, then lateral epi cluster (SG) |
| Larval GFP | cns |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-04-21 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np28635_0807 |
| Strand | Plus |
| Insertion Point | 14384817 |
| Chromosome Band | X |
| Flanking Sequence | antctttggggnaaaaaaccctttttttgtntacttcggtaagcttcggctatcgacggg accaccttatgttatttcatcatgGTCGGGCTGCTTGTCCACAGGCGACTGTGTGTTCGT TTTCGTTCGTCGCTCGTTTTTTCGGTTTTTCGGTTTCCCGCGAGGTGTCGTCTGCACGTG CGTGTATGCGTGTGGGTGACTGTGTGTGTGTGTGAGTTTGTTNNTGACCCGCGCTTGAga tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtttt caggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagc atccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaat cgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcact tattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnttttttnttn ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann |