| Strain Information | |
|---|---|
| DGRC Number | 104674 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP4431 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP4431 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 94E13 |
| Map Viewer |  |
| Related Genes | pnt DNApol-epsilon |
| Original Number | 4431 |
| Chromosome | 3 |
| Comments | Flies are Sb, indicating that they have TM3 balancer instead of TM6. 28Feb2017 T.O. FlyBase Insertion: P{GawB}NP4431 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 1606 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | muscle subset |
| Larval GFP | gut |
| Larval X-gal | adepitherial cells, oenocyte, mt, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np16895_0727 |
| Strand | Minus |
| Insertion Point | 19162545 |
| Chromosome Band | 3R |
| Flanking Sequence | ntttctnggggtganaaaccccttttttnggatacttcgnaaagccttcggctatcgacg ggaccaccttatgttatttcatcatgGGTCAGTCTGTTTTTGTCTTTCTTTCGGGAAGCG TGCACTTGCGCTACGGTAAATTCGATTTGAATGAATTAAACGAATCAAATAACAAATAAA TAACAAATGCAAAACACTTTGCAAGCCAAGCANNTTNNNAGTGTGTAAGTGAATGAGTGC AATAGCAAAACATCTAAAgatcgaagaatacataagagagaaccgtcgccaaagaaccca ttattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagac caatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatca tgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctct tccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctcc actgaagcatnttnttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
