| Strain Information | |
|---|---|
| DGRC Number | 104688 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Pak3[NP4472] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}Pak3NP4472 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 89C7 |
| Map Viewer |  |
| Related Genes | CG10405 CG14882 Pak3 |
| Original Number | 4472 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP4472 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 1519 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | restain |
| Larval X-gal | sg, gut, cns |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Ozdowski EF, Wentzell JS, Engert SM, Abbott H, Sherwood NT. Suppression of spastin Mutant Phenotypes by Pak3 Loss Implicates a Role for Reactive Glia in AD-HSP. Front Neurosci (2020) 14 912 [PubMed ID = 33013303] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np69795_0810 |
| Strand | Minus |
| Insertion Point | 12278811 |
| Chromosome Band | 3R |
| Flanking Sequence | atntttgggcgtgcactgcanttttgtgtatacttncggtagncttcggctatcgacggg naccaccttatgttatttcatcatgGGCTTGAGTAACAGTAACATTAACAATACCGAACG CGAAACAACAACAAATCTGCCGAGCGTTTAGAATTTCCCAAGTCGAGCGTTACTAAACGC ATTGAAGAAAATCCCCCCCACCCACACACACTCTTATATACATTTTCCGCTGGAAAATGA GCTTCACCAAGTGGTTCAAGAAGAAGGGCGGAGATGGGGgatcgaagaatacataagaga gaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatcc gacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggcataaaatcc aacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagncaactgtctt tgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaat gttagaggcatatcagtctccactgagntcnnnnnnntnggggnnnnnnnntnnnnngnn anctgnnnnatacnctngaccngggaccctnattntnntttnatttnttntnnnancnaa agngnaannggggnnngnnaaacttnnattncctatnngnntnncanannngnnctnncn nnnngnnngnccnaagnnnnnnnnncnnaannncncaggggnnnntnnnncgnnnnnntt tttnnnaaaanntnnttnnnngnaannnncnttnnnnnnnnnnnnnnannnnnnnaannn nnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnngnnnnnnngnnaanttttnntnn nnngnnnaaaaannnnnnnn |