| Strain Information | |
|---|---|
| DGRC Number | 104910 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Arf51F[NP5226] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}Arf51FNP5226 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 51F6 |
| Map Viewer |  |
| Related Genes | mus210 CG8155 Arf51F CG8157 |
| Original Number | 5226 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP5226 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 777 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | weak stripes in stg 14, scattered pattern later. amx? |
| Larval GFP | fb |
| Larval X-gal | not in discs. (s.g.) |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Acevedo SF, Peru y Colon de Portugal RL, Gonzalez DA, Rodan AR, Rothenfluh A. S6 Kinase Reflects and Regulates Ethanol-Induced Sedation. J Neurosci (2015) 35(46) 15396-402 [PubMed ID = 26586826] [RRC reference] Peru Y Colon de Portugal RL, Acevedo SF, Rodan AR, Chang LY, Eaton BA, Rothenfluh A. Adult neuronal Arf6 controls ethanol-induced behavior with Arfaptin downstream of Rac1 and RhoGAP18B. J Neurosci (2012) 32(49) 17706-13 [PubMed ID = 23223291] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np49235_0912 |
| Strand | Minus |
| Insertion Point | 10386578 |
| Chromosome Band | 2R |
| Flanking Sequence | tttttnggggcantgaccttatttttatncttcggtaagctncggctatcgacgggacca ccttatgttatttcatcatgGGAGCAACGATATCGGATGGTTTTCGGATTCTACGGAATT TCGCTCGCTCTCTCGCTGCTGCTTGCCTACGTCACAAACACGCCCGTAACACACATACAC ATGTATACACACCCAAGTCTCCGACGACCGCCGTTACGCACCGCTTTCCAGCCCAATTCG TTCCACGCCAGCCTGAAATCCGTTAACATGTAGTGCCAAAGTGCGCGGGCCGGGGCATAA AATGCATTTGCTAGCACACGGCGGCCAAAAAACTATAACTAACAACAACAATTTTGCACT AATCTTCTTGTATTTATATACACATACACGAAGCANTGTGCCCGTTAGCGCAGAGCGGAA CAAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattggtggggtcc gttttcaggaagggcaagccatccgacatgtcatcctctttagaccaatcaaatccatga agagcatcccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccga gtcaatcgatacagtcaactggtctttgacctttggtactactctcttccgatgatgatg ncgcacttattctatgctgnctcaatggtagaggcatatcagtctncactgaagccattn tnttttggnntnntttnntgttcgncttttttcncntcnnnnncctnnnntcccccncnn ccnttncgnnnnnnnttctccntnctnntncnttttttttttntnntnnnncccgtttnc cncnnntnntttcttcaannnccnnntttngntctnggcgtntccnctcttttnntccan ncncnnccannacccnn |
