| Strain Information | |
|---|---|
| DGRC Number | 105136 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}NP6120 / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}NP6120 / FM7c |
| Break points/Insertion Site | 8E10 |
| Map Viewer | ![]() |
| Related Genes | Hex-A CG32699 |
| Original Number | 6120 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP6120 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 245 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | muscle (from stg 16) |
| Larval GFP | ubiquitous. |
| Larval X-gal | scattered cells in wing pouch, |
| Adult GFP | ubiquitous, strong |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Slaninova V, Krafcikova M, Perez-Gomez R, Steffal P, Trantirek L, Bray SJ, Krejci A. Notch stimulates growth by direct regulation of genes involved in the control of glycolysis and the tricarboxylic acid cycle. Open Biol (2016) 6(2) 150155 [PubMed ID = 26887408] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np44245_0912 |
| Strand | Plus |
| Insertion Point | 9323650 |
| Chromosome Band | X |
| Flanking Sequence | ttttncgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaaccc ccttatgttatttcatcatgGGGTAAACCTTGCTCTTTCTCATCTAAAACGGCATTGTTA TACTAACACCGATGCCGAGGGAGAGCGAgatcgaagaatacataagagagaaccgtcgcc aaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatc ctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgt ggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgtt actactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcat atcagtctccactnagntnttnntttttnnggnggggnnnnnnnnnntnttnttnnnnna nnnnnnnnnnnnnnnnannnnnnnncnngnnnnannaannnnnntnnnnnnnnnnnngnn naannaannncnnnnnnnnaaaaannnnnnnnnnnnnggnnnntttnnnnnnngggnaaa aannnnnnnnnnnaaannnnnnnnnnnnnnnnnnnnnntttnnnannccntnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnncccnnnnnnnnnnnnnnnnnnnnnncnnttnnn nnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnn |
| Image Files | ||
|---|---|---|
| Embryo |
|
|