| Strain Information | |
|---|---|
| DGRC Number | 105209 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}smi35A[NP6341] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}smi35ANP6341 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 35A2 |
| Map Viewer | ![]() |
| Related Genes | wb smi35A |
| Original Number | 6341 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP6341 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 1184 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | a small number of cell (TU) |
| Larval GFP | asp, psp, sg |
| Larval X-gal | sg, weak fb, weak epi |
| Adult GFP | ant, lb, probosis, distal leg, muscle in leg? not in wing mergin. Dll-like |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np48325_0912 |
| Strand | Plus |
| Insertion Point | 14196721 |
| Chromosome Band | 2L |
| Flanking Sequence | ctgaattaagtgttacttcggtaagcttcggctatcgacgggaccaccttatgttatttc atcatgCTTCAGCTTAATTGTTGCTACGTGTACTTTTTTTGAGAAAAAATGTTTGTTGTC TTGGGGTAATTGTTGCTTATTTGCCTGCATGCTTGCCTGCCAGTCGTCTGCTgatcgaag aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa gggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccct gggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtcaatcgatac agtcaactgnctttgacctttgntactactctcttccgatgatgatgtcgcacttattct atgctgnctcaatggtagaggcatatcagtctccactgagcatctttttttttggggnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnn |