Detailed Information [105257]
 

Strain Information
DGRC Number 105257
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}ato[NP6558] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}atoNP6558 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 84F6
Map Viewer
Related Genes CG11671 ato CG9630
Original Number 6558
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6558

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:84F1-F7
Balancer TM6UW23-1
Cluster id 1381
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression leg disc? stripes in abdomenal epi,
Larval GFP sg
Larval X-gal ch organ, PNS,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2026-08-04
Research papers using this strain
[Please submit your publication]
Lyu C, Li Z, Xu C, Wong KKL, Luginbuhl DJ, McLaughlin CN, Xie Q, Li T, Li H, Luo L.
Dimensionality reduction simplifies synaptic partner matching in an olfactory circuit.
Science (2025) 388(6746) 538-544 [PubMed ID = 40310920] [RRC reference]

Chai PC, Cruchet S, Wigger L, Benton R.
Sensory neuron lineage mapping and manipulation in the Drosophila olfactory system.
Nat Commun (2019) 10(1) 643 [PubMed ID = 30733440] [RRC reference]

Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Okumura M, Kato T, Miura M, Chihara T.
Hierarchical axon targeting of Drosophila olfactory receptor neurons specified by the proneural transcription factors Atonal and Amos.
Genes Cells (2016) 21(1) 53-64 [PubMed ID = 26663477] [RRC reference]

Otsuna H, Ito K.
Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways.
J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46535_0912
Strand Plus
Insertion Point 4103686
Chromosome Band 3R
Flanking Sequence
tttttagacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGTGGCAACTCGTTTACCTGCCCCCCTACCTGCCTTTCA
GGCCCTTCTGACCGTCGTGGTGGATTTGTGAGTATAAATAGGGCCGAAAGGACGAGAGAC
CAGTCAGAAACCCGCCAGCACTCGCAGCGTTCGTACCGTTTCATCCAGCAACATAACACC
ACCATACAGCAGCAGCAACATGTCGTCCAGTGAgatcgaagaatacataagagagaaccg
tcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatg
tcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgga
attgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccc
tttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttag
aggcatatcagtctccctngctcccttntnnnngggggggggnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)

e7 (->Large)

CLOSE