| Strain Information | |
|---|---|
| DGRC Number | 105257 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}ato[NP6558] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}atoNP6558 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 84F6 |
| Map Viewer |  |
| Related Genes | CG11671 ato CG9630 |
| Original Number | 6558 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP6558 NP line. Received from the National Institute of Genetics. |
| Original Comments | comment1:A, comment2:84F1-F7 |
| Balancer | TM6UW23-1 |
| Cluster id | 1381 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | leg disc? stripes in abdomenal epi, |
| Larval GFP | sg |
| Larval X-gal | ch organ, PNS, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Lyu C, Li Z, Xu C, Wong KKL, Luginbuhl DJ, McLaughlin CN, Xie Q, Li T, Li H, Luo L. Dimensionality reduction simplifies synaptic partner matching in an olfactory circuit. Science (2025) 388(6746) 538-544 [PubMed ID = 40310920] [RRC reference] Chai PC, Cruchet S, Wigger L, Benton R. Sensory neuron lineage mapping and manipulation in the Drosophila olfactory system. Nat Commun (2019) 10(1) 643 [PubMed ID = 30733440] [RRC reference] Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH. Mapping chromatic pathways in the Drosophila visual system. J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference] Okumura M, Kato T, Miura M, Chihara T. Hierarchical axon targeting of Drosophila olfactory receptor neurons specified by the proneural transcription factors Atonal and Amos. Genes Cells (2016) 21(1) 53-64 [PubMed ID = 26663477] [RRC reference] Otsuna H, Ito K. Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways. J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np46535_0912 |
| Strand | Plus |
| Insertion Point | 4103686 |
| Chromosome Band | 3R |
| Flanking Sequence | tttttagacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgGTGGCAACTCGTTTACCTGCCCCCCTACCTGCCTTTCA GGCCCTTCTGACCGTCGTGGTGGATTTGTGAGTATAAATAGGGCCGAAAGGACGAGAGAC CAGTCAGAAACCCGCCAGCACTCGCAGCGTTCGTACCGTTTCATCCAGCAACATAACACC ACCATACAGCAGCAGCAACATGTCGTCCAGTGAgatcgaagaatacataagagagaaccg tcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatg tcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgga attgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccc tttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttag aggcatatcagtctccctngctcccttntnnnngggggggggnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
