| Strain Information | |
|---|---|
| DGRC Number | 105287 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}CG9855[NP6612] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}CG9855NP6612 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 82B1 |
| Map Viewer | ![]() |
| Related Genes | CG14646 CG14647 CG9855 |
| Original Number | 6612 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP6612 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 1312 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | bipolar cell? weak muscle, pns subset? |
| Larval GFP | epi, fb, gut, tr. |
| Larval X-gal | sg, fb, weak epi |
| Adult GFP | probosis, abd |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np01475_0711 |
| Strand | Plus |
| Insertion Point | 223575 |
| Chromosome Band | 3R |
| Flanking Sequence | gggngngnntgtttttttnttgttngantgaccgggnnnngcgnacctaacnngggcttn gaaaaccnccggctatcgacgggaccaccttttgttatttcatcatgCTACCAGGGCNCT TTCAATGATTTTTCGGACGGACCAgatcgaagaatacataagagagaaccgtcgccaaag aacccattattgttggggtccgttttcaggaagggcaagccatccgacatgttntcctct tcnttncaatcaaatccatgaagagcatccntgggcataaaatccaacggaattgtggag ttatcatgatgagctgccgagncaatcgatacagtcaactgtctttgacctttgttacta ctctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatca gtctccactgaagccatcttattctgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Embryo |
|
|