Strain Information | |
---|---|
DGRC Number | 105442 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP7379 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP7379 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 37F1 |
Map Viewer | |
Related Genes | CG10337 TepIV |
Original Number | 7379 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP7379 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 1245 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | sg |
Larval GFP | sg |
Larval X-gal | gut (mg?) |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Ghosh S, Chakraborti S, Devi D, Sahu R, Mandal S, Mandal L. A conserved nutrient responsive axis mediates autophagic degradation of miRNA-mRNA hybrids in blood cell progenitors. Nucleic Acids Res (2024) 52(1) 385-403 [PubMed ID = 37994707] [RRC reference] Goins LM, Girard JR, Mondal BC, Buran S, Su CC, Tang R, Biswas T, Kissi JA, Banerjee U. Wnt signaling couples G2 phase control with differentiation during hematopoiesis in Drosophila. Dev Cell (2024) [PubMed ID = 38866012] [RRC reference] Kanwal A, Joshi PV, Mandal S, Mandal L. Ubx-Collier signaling cascade maintains blood progenitors in the posterior lobes of the Drosophila larval lymph gland. PLoS Genet (2021) 17(8) e1009709 [PubMed ID = 34370733] [RRC reference] Tiwari SK, Toshniwal AG, Mandal S, Mandal L. Fatty acid β-oxidation is required for the differentiation of larval hematopoietic progenitors in Drosophila. Elife (2020) 9 [PubMed ID = 32530419] [RRC reference] Blanco-Obregon D, Katz MJ, Durrieu L, Gandara L, Wappner P. Context-specific functions of Notch in Drosophila blood cell progenitors. Dev Biol (2020) 462(1) 101-115 [PubMed ID = 32243888] [RRC reference] Sharma SK, Ghosh S, Geetha AR, Mandal S, Mandal L. Cell Adhesion-Mediated Actomyosin Assembly Regulates the Activity of Cubitus Interruptus for Hematopoietic Progenitor Maintenance in Drosophila. Genetics (2019) 212(4) 1279-1300 [PubMed ID = 31138608] [RRC reference] Tokusumi T, Tokusumi Y, Schulz RA. The mir-7 and bag of marbles genes regulate Hedgehog pathway signaling in blood cell progenitors in Drosophila larval lymph glands. Genesis (2018) 56(5) e23210 [PubMed ID = 29663653] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np06925_0711 |
Strand | Plus |
Insertion Point | 19526381 |
Chromosome Band | 2L |
Flanking Sequence | GGGGGNANGNGNGTGTGTAGTTTNTTTGTNNGGANNCANACGGGNGTTCAATAAACCCGT NACTTGGGNCTNNCGGTAAAGACTCCCGGCTATCGACGGGNACCACCTTTTTTTATTTCA TCATGAGAGCGACATCTAACAAAACAACAACAGCTGACTCAGTAGAGAGCAGGAAAGAGT TTTCGATATATATGTACACAACGCCTAGTCAGTTGGTCTCCGTATTTCGATTTAGGAGGC AGTTCCGTTAACANTNNAAATCAACAAGTCCAAATAATATTGCACGCACGTNAGGGGCCA CACGACAAAAACATAAATATTTGTATTCAATTCATATATTGGGATTTTACGCGAGATCGA AGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGG AAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCC CTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGAT ACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATT CTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAGCATNNNNNNTNGGGGGNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNN NNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |