| Strain Information | |
|---|---|
| DGRC Number | 109761 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}Hsp83[KM0022] |
| Genotype | w1118; PBac{EGFP-IV}Hsp83KM0022 |
| Break points/Insertion Site | 63B11 |
| Related Genes | Hsp83 |
| Received Date | 22 November 2012 |
| Original Number | 22 |
| Chromosome | 3L |
| Comments | Expression Photo: KM0022 |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 3L:3193869 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 63B11 Inserted gene: Hsp83 Protein trap?: Yes (N terminal fusion) Insertion into Intron or Exon?: Intron (5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): R Orientation of GFP exon and its frame against inserted gene: same orientation and frame and no premature stop(5'UTR Intron) |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
kΊ εχ ΧEΰ{\[^pNΏxΜPν«§δ@\Μβ`wIπΝ δΊ¬ι½ε€§ε¦ ε士θ«ζ (2024) [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 3L:3193869 |
| Chromosome Band | 63B11 |
| Flanking Sequence | NCTNTTGCGCCNTTTGATATCTGTAAGAGCAGAAAAAATTAGCTGCAGATAAATAAACCT CGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACG TCGCAATATGATTATCTTTCTAGGGTTAAAAAGCCTATTTGGCACGCTGTTTAATTCATG CTAAAGCATAGAAACCTCTAGAACATTCTCGAGCGGCAAATGTGATTTGCGCATTGTCAC CCCTAAAAAGAGCGG |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |