| Strain Information | |
|---|---|
| DGRC Number | 112334 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG8290[NP0793] / CyO |
| Genotype | w*; P{w+mW.hs=GawB}CG8290NP0793 / CyO |
| Break points/Insertion Site | 48D5 |
| Map Viewer |  |
| Related Genes | BEST:LD29214 CG8979 |
| Original Number | 793 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP0793 NP line. Received from the National Institute of Genetics. |
| Balancer | CyO |
| Cluster id | 697 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | semi lethal |
| Embryonic Expression | cns |
| Larval X-gal | sg |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Lopez-Falcon B, Meyer-Nava S, Hernandez-Rodriguez B, Campos A, Montero D, Rudino E, Vazquez M, Zurita M, Valadez-Graham V. Characterization of the Drosophila group ortholog to the amino-terminus of the alpha-thalassemia and mental retardation X-Linked (ATRX) vertebrate protein. PLoS One (2014) 9(12) e113182 [PubMed ID = 25437195] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np25685_0807 |
| Strand | Plus |
| Insertion Point | 7035397 |
| Chromosome Band | 2R |
| Flanking Sequence | tgatnngtntttttgggnngantnnncggggtggaaaacggnacccctaanctngggggc tncggaaaaaccccnggctattngacgggnaccaccttntgttatttcatcatgATTCAG CTGTCTTTCTCGGGTGAAAAAATCTGACACATTTTCGAGGAGACTTGCTGCGAAGCATTC AGTACAGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggg gtccgttttcaggatnggcaagccatccgacatgtcatcctnttcagaccaatcaaatcc atgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgc cgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatga tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccat cttattttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nn |