| Strain Information | |
|---|---|
| DGRC Number | 112600 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Gpo-1[NP1279] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}Gpo-1NP1279 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 52C8 |
| Map Viewer | ![]() |
| Related Genes | CG12970 CG30085 l(2)k05713 |
| Original Number | 1279 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP1279 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 789 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | sg, mg (SG) |
| Larval GFP | no larva |
| Larval X-gal | sg, gut, tr, mt |
| Adult GFP | no adult |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np17655_0807 |
| Strand | Plus |
| Insertion Point | 10925377 |
| Chromosome Band | 2R |
| Flanking Sequence | atnttttgngtgcactgcattttgtgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgCAACAGACTGAATGCGAAACACAGAAAAGCCGAAGTCGC CCGATTTCCGACCAGCGAGAATTGGAATGAGTATGCCAATGGCAATGCGAACGGAACGAT TTTAGCGGCGGCCGTAATGGCATGTGAAAATGATTACATCAGAGTTTGAGTCACTTTTCC GCGACACTCGCCGTCGTTTTGCCGCTACCCGCATCCGCACTCGGCCAAGGCAAATCGGTT ATTGAGCTCACCTAGTGCTCTGGATGCTATCTgatcgaagaatacataagagagaaccgt cgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgt catcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaa ttgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctt tgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagag gcatatcagtctccactgagntttttttttttnnggggnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |