| Strain Information | |
|---|---|
| DGRC Number | 112622 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}nab[NP1316] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}nabNP1316 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 64A9 |
| Map Viewer |  |
| Related Genes | CG15001 mas |
| Original Number | 1316 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}nab[NP1316] NP line. Received from the National Institute of Genetics. |
| Also known as | nabGal4[NP1316] P{GawB}NP1316 nab-GAL4 P{GawB}NP1316 |
| Balancer | TM6UW23-1 |
| Cluster id | 1771 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | cns (SG) |
| Larval GFP | cns |
| Larval X-gal | pouch |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Girard V, Sorge S, Kurth J, Alexandre C, Gould AP. ShineGAL4 drivers for tissue and cell-type specific optogenetics in Drosophila. Development (2026) 153(4) [PubMed ID = 41738557] [RRC reference] Narbonne-Reveau K, Erni A, Eichner N, Sankar S, Kapoor S, Meister G, Cremer H, Maurange C, Beclin C. In vivo AGO-APP identifies a module of microRNAs cooperatively preserving neural progenitors. PLoS Genet (2025) 21(4) e1011680 [PubMed ID = 40299997] [RRC reference] Genovese S, Clement R, Gaultier C, Besse F, Narbonne-Reveau K, Daian F, Foppolo S, Luis NM, Maurange C. Coopted temporal patterning governs cellular hierarchy, heterogeneity and metabolism in Drosophila neuroblast tumors. Elife (2019) 8 [PubMed ID = 31566561] [RRC reference] Narbonne-Reveau K, Maurange C. Developmental regulation of regenerative potential in Drosophila by ecdysone through a bistable loop of ZBTB transcription factors. PLoS Biol (2019) 17(2) e3000149 [PubMed ID = 30742616] [RRC reference] Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np20235_0807 |
| Strand | Minus |
| Insertion Point | 4141606 |
| Chromosome Band | 3L |
| Flanking Sequence | actnttttgcgtgcactgnatttaattgtatacttcggtaagcttcggctatcgacggga ccaccttatgttatttcatcatgGTTCCTCAGATGTCCGTTCTGGGATTCGTGCACAGAA GTTCGTCTGGCCTCGAGCTGAGCGgatcgaagaatacataagagagaaccgtcgccaaag aacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctct tcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggag ttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttacta ctctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatca gtctccactgagcatcttnntntttggggnnnnnnntttnttnnnntnnnnttnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Disc |
|
|
