Strain Information | |
---|---|
DGRC Number | 112688 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP1546 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP1546 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | --- |
Map Viewer | |
Related Genes | CG40138 CG40370 |
Original Number | 1546 |
Chromosome | 2 |
Comments | NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 2109 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | pns ch, (SG) |
Larval GFP | cns + pns, epi |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np53365_0227 |
Strand | Plus |
Insertion Point | 4118804 |
Chromosome Band | U |
Flanking Sequence | ttnancgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac cttatgttatttcatcatgGCCCGAAAACACGAGAGCCGAGCGCTGGTGAGTCCTGACGA Agatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgt tttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaag agcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtc aatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgc acttattctatgctgtctcaatgttagaggcatatcagtctccactgagctcttattttt ngggggggnnnnntnnttntnnngnngnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnna nnnnnnnnnnnnncntntntnnnnnnnannannnnnnnncccnnntntatgnnggnnnna ntgtnnnannngnaannnnnntccnntnnnnncaatnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |