| Strain Information | |
|---|---|
| DGRC Number | 112748 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG18549[NP2022] / TM3, Sb[1] Ser[1] |
| Genotype | w*; P{w+mW.hs=GawB}CG18549NP2022 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 87B11 |
| Map Viewer | ![]() |
| Related Genes | CG18549 CG5509 CG5538 |
| Original Number | 2022 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP2022 NP line. Received from the National Institute of Genetics. |
| Balancer | TM3 Sb Ser |
| Cluster id | 1458 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | a small# o cells |
| Larval GFP | sg |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np26635_0807 |
| Strand | Minus |
| Insertion Point | 8275450 |
| Chromosome Band | 3R |
| Flanking Sequence | tnanttttcttcggtagcttcggctatcgacgggaccaccttatgttatttnatcatgGT CTGGAATGCCGTAAAGACGAACATAAAGCCAAAGCCCAGGATGAGTATCATTAAGAATTT GAAATCCATCCTGCTGCTGCGCTATGTCTTTTCCAATCACAATAGAACCGAATTAAATTA ACTTGCCGCGCACTTTTGCATTTGCGTTTGCAGTTGCCGACGTAACCAGAGAGGGGGAga tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtttt caggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagc atccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaat cgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcact tattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatncttttntt ggggnnnnnnnnnnngnnnnnnntttnnnnnnanntcntagtnannaaagagnagnnaga ngaggggnnagtagangngagnanagagnnanannagataantntntntcnnnangctnn nncncnacgcttttttttttncnntntnnnnnntnnnnctnctnttnntctccnctcncc ntnnctntnnnnntnnacnannnantnnncatntnatnnnnnntnnnnctntnnntctnn nnnnnnnnnnnnnnnntttntcnnnnnnccnngnnnnnnntncnnnnntnntnttnntnn tcnnnnnttcccncnncnnntncntnnnnnncnnanttntnnnttcttnnnncnnnntnn cngnccccnntnnttnnntntttccnnnggngncntanangnnnnttnttntntcnnnng nnnnnnntnnann |
| Image Files | ||
|---|---|---|
| Disc |
|
|