| Strain Information | |
|---|---|
| DGRC Number | 112853 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}spin[NP2276] / CyO |
| Genotype | w*; P{w+mW.hs=GawB}spinNP2276 / CyO |
| Break points/Insertion Site | 52E7 - 52E5 |
| Map Viewer | ![]() |
| Related Genes | CG30095 spin CG8430 |
| Original Number | 2276 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP2276 NP line. Received from the National Institute of Genetics. |
| Also known as | SPG-2-Gal4 |
| Balancer | CyO |
| Cluster id | 798 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | cns, yolk |
| Larval GFP | gut, fb |
| Larval X-gal | mt, fb, oenocyte |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-05-16 |
| Research papers using this strain [Please submit your publication] |
Lin KY, Gujar MR, Lin J, Ding WY, Huang J, Gao Y, Tan YS, Teng X, Christine LSL, Kanchanawong P, Toyama Y, Wang H. Astrocytes control quiescent NSC reactivation via GPCR signaling-mediated F-actin remodeling. Sci Adv (2024) 10(30) eadl4694 [PubMed ID = 39047090] [RRC reference] Prasad AR, Lago-Baldaia I, Bostock MP, Housseini Z, Fernandes VM. Differentiation signals from glia are fine-tuned to set neuronal numbers during development. Elife (2022) 11 [PubMed ID = 36094172] [RRC reference] Texada MJ, Lassen M, Pedersen LH, Koyama T, Malita A, Rewitz K. Insulin signaling couples growth and early maturation to cholesterol intake in Drosophila. Curr Biol (2022) 32(7) 1548-1562.e6 [PubMed ID = 35245460] [RRC reference] Park YJ, Kim S, Shim HP, Park JH, Lee G, Kim TY, Jo MC, Kwon AY, Lee M, Lee S, Yeo J, Chung HL, Bellen HJ, Kwon SH, Jeon SH. Phosphatidylserine synthase plays an essential role in glia and affects development, as well as the maintenance of neuronal function. iScience (2021) 24(8) 102899 [PubMed ID = 34401677] [RRC reference] Coll-Tane M, Gong NN, Belfer SJ, van Renssen LV, Kurtz-Nelson EC, Szuperak M, Eidhof I, van Reijmersdal B, Terwindt I, Durkin J, Verheij MMM, Kim CN, Hudac CM, Nowakowski TJ, Bernier RA, Pillen S, Earl RK, Eichler EE, Kleefstra T, Kayser MS, Schenck A. The CHD8/CHD7/Kismet family links blood-brain barrier glia and serotonin to ASD-associated sleep defects. Sci Adv (2021) 7(23) [PubMed ID = 34088660] [RRC reference] Okamoto N, Yamanaka N. Steroid Hormone Entry into the Brain Requires a Membrane Transporter in Drosophila. Curr Biol (2020) 30(2) 359-366.e3 [PubMed ID = 31928869] [RRC reference] Okamoto N, Nishimura T. Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth. Dev Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference] Stratoulias V, Heino TI. MANF silencing, immunity induction or autophagy trigger an unusual cell type in metamorphosing Drosophila brain. Cell Mol Life Sci (2015) 72(10) 1989-2004 [PubMed ID = 25511196] [RRC reference] Seabrooke S, O'Donnell MJ. Oatp58Dc contributes to blood-brain barrier function by excluding organic anions from the Drosophila brain. Am J Physiol Cell Physiol (2013) 305(5) C558-67 [PubMed ID = 23804204] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np22395_0807 |
| Strand | Plus |
| Insertion Point | 11194991 |
| Chromosome Band | 2R |
| Flanking Sequence | gagggaaannatgatnngttttgggnnnattaacgttgtgaaaaaccncatttttgggac nncggaaagacctcggctatcgacgggaccaccttatgttatttcatcatgATTTGGGAC TTACGTAAAACACTCGAATATAGCAAGCTTGTATTAACGATTTATATGGTTTGTCAATTA ACAACTCCCGCTGAGGATGGGCTGATATGTACGAAGTACAATGTATACAATGTATATCAC ACATCACGCGAATTCCTAATACATAATGCCAATAAAAGAGTAATACATAATACTGTATGT TCATTTACATTTCCACCGATACCACTTTTCTAAAATGTACATTTCGAAAAGgatcgaaga atacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaag ggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctg ggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaaatcgatac agtcaactgtctttgacctttgntactactctcttgcgatgatgatgtcgcacttattct atgctgtctcaatgttagaggcatatcagtctccactgagntntttntttnnggggnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnn |