Strain Information | |
---|---|
DGRC Number | 113013 |
Genotype with FlyBase Link | y[*] P{w[+mW.hs]=GawB}NP2699 w[*] / FM7c |
Genotype | y* P{w+mW.hs=GawB}NP2699 w* / FM7c |
Break points/Insertion Site | 2C8; -; 2C9 |
Map Viewer | |
Related Genes | CG14054 EG:22E5.6 EG:22E5.7 |
Original Number | 2699 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP2699 NP line. Received from the National Institute of Genetics. |
Balancer | FM7c |
Cluster id | 55 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | gut |
Larval GFP | tr |
Larval X-gal | sg |
Adult GFP | internal (MT) |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np24275_0807 |
Strand | Minus |
Insertion Point | 1821921 |
Chromosome Band | X |
Flanking Sequence | ancttttggtgcactgactttanttttatacttcggtaagcttcggctatcgacgggacc accttatnttatttcatcatgGAACAACCGATGGTTTTCGAAGACACTATCGCAAATCGC ATACCGAAGTGATTTCTGGTGCATTTTTGTTTCTTGTTTGTGCACGTGCAGAACGCAAAT AAATGCGCCGAGCCTGAGTCAATGCGAGCGGACAGGAGGACANCGGATAGCGGGCGGCCA TGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccg ttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaa gagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagt caatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcg cacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnnnnttn ttngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnntnnnnnnnntnnnnnnnnnnnntnnnnnnntnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnan |